diff --git a/.travis.yml b/.travis.yml index 5ebfa0f2..4fc92566 100644 --- a/.travis.yml +++ b/.travis.yml @@ -1,4 +1,20 @@ -language: bash +language: cpp + +compiler: + - gcc + - clang + +before_install: + - sudo add-apt-repository -y ppa:kalakris/cmake + - sudo add-apt-repository -y ppa:boost-latest/ppa + - sudo add-apt-repository -y ppa:ubuntu-toolchain-r/test + - sudo apt-get -qq -d update + +install: + - sudo apt-get -qq install libboost1.55-all-dev cmake g++-4.8 + - sudo update-alternatives --install /usr/bin/g++ g++ /usr/bin/g++-4.8 90 script: - bin/configlet-linux-amd64 . + - cmake -G "Unix Makefiles" + - make diff --git a/CMakeLists.txt b/CMakeLists.txt new file mode 100644 index 00000000..abdefcbd --- /dev/null +++ b/CMakeLists.txt @@ -0,0 +1,59 @@ +cmake_minimum_required(VERSION 2.8.11) +project(exercism CXX) + +set(Boost_USE_STATIC_LIBS ON) +set(Boost_USE_MULTITHREADED ON) +set(Boost_USE_STATIC_RUNTIME OFF) +find_package(Boost 1.55 REQUIRED COMPONENTS unit_test_framework date_time regex) + +if(("${CMAKE_CXX_COMPILER_ID}" MATCHES "GNU") OR ("${CMAKE_CXX_COMPILER_ID}" MATCHES "Clang")) + set(CMAKE_CXX_FLAGS "-std=c++11") +endif() + +add_definitions(-DEXERCISM_RUN_ALL_TESTS) + +function(travis_fixup file) + if(EXISTS ${CMAKE_CURRENT_SOURCE_DIR}/example.h) + file(RENAME ${CMAKE_CURRENT_SOURCE_DIR}/example.h ${CMAKE_CURRENT_SOURCE_DIR}/${file}.h) + endif() + if(EXISTS ${CMAKE_CURRENT_SOURCE_DIR}/example.cpp) + file(RENAME ${CMAKE_CURRENT_SOURCE_DIR}/example.cpp ${CMAKE_CURRENT_SOURCE_DIR}/${file}.cpp) + endif() +endfunction() + +function(exercism exe) + string(REPLACE "-" "_" file ${exe}) + travis_fixup(${file}) + if(EXISTS ${CMAKE_CURRENT_SOURCE_DIR}/${file}.cpp) + set(exercise_cpp ${file}.cpp) + else() + set(exercise_cpp "") + endif() + add_executable(${exe} ${file}_test.cpp ${exercise_cpp} ${file}.h) + target_include_directories(${exe} PRIVATE ${Boost_INCLUDE_DIRS}) + target_link_libraries(${exe} ${Boost_LIBRARIES}) + add_custom_command(TARGET ${exe} POST_BUILD COMMAND ${exe}) +endfunction() + +foreach(exercise + bob + word-count + hamming + anagram + food-chain + beer-song + nucleotide-count + rna-transcription + phone-number + grade-school + robot-name + leap + etl + space-age + grains + gigasecond + triangle + clock +) + add_subdirectory(${exercise}) +endforeach() diff --git a/SETUP.md b/SETUP.md new file mode 100644 index 00000000..c9ca1282 --- /dev/null +++ b/SETUP.md @@ -0,0 +1,173 @@ +## Passing the Tests + +Get the first test compiling, linking and passing. Once you've done that, +uncomment the next test by moving the following line past the next test. + +```C++ +#if defined(EXERCISM_RUN_ALL_TESTS) +``` + +This may result in compile errors as new constructs may be invoked that +you haven't yet declared or defined. Fix the compile errors minimally +to get a failing test, then change the code minimally to pass the test, +refactor your implementation for readability and expressiveness and then +go on to the next test. + +Try to use standard C++11 facilities in preference to writing your own +low-level algorithms or facilities by hand. [CppReference](http://en.cppreference.com/) +is a wiki reference to the C++ language and standard library. If you +are new to C++, but have programmed in C, beware of +[C traps and pitfalls](http://www.slideshare.net/LegalizeAdulthood/c-traps-and-pitfalls-for-c-programmers). + +## Building and Running the Tests + +The C++ language track assumes that you have the appropriate development tools +installed on your system: a modern C++11 compiler, some sort of build +system and the Boost libraries. MacOS Xcode and Windows Visual Studio +IDEs combine the compiler and the build system into a single IDE (integrated +development environment). Unix environments typically expose the +compiler and build system as separate command-line tools. + +### Prerequisite: Using a Modern C++11 Compiler + +This language track assumes C++11, the latest version of the ISO C++ standard. +Free compilers exist for C++11 on all major platforms, although the version +of the C++ compiler installed on your system may be an older version that +doesn't fully support C++11. + +Unix users will need gcc 4.8 or later or clang 3.4 or later for the compiler +and `make` will be needed for build engine. Make is pre-installed on most +unix systems, but is available via `sudo apt-get install make` if not present. +Gcc 4.8 supports C++11 with the `-std=c++11` argument and can be installed and +set as the default compiler with the following recipe: + +```bash +$ sudo add-apt-repository -y ppa:ubuntu-toolchain-r/test +$ sudo apt-get -qq -d update +$ sudo apt-get -qq install g++-4.8 +$ sudo update-alternatives --install /usr/bin/g++ g++ /usr/bin/g++-4.8 90 +``` + +Windows users can get +[Visual Studio Express 2013 for Windows Desktop](http://www.visualstudio.com/downloads/download-visual-studio-vs#d-express-windows-desktop), +a free download that will give you the Visual Studio 2013 IDE and the +latest version of the Microsoft Visual C++ compiler. + +MacOS users can install gcc 4.8 with [Homebrew](http://brew.sh/) via +`brew install gcc`. + +### Prerequisite: Installing Boost.Test + +The unit tests use Boost.Test, the unit testing framework included with +[Boost](http://www.boost.org/index.html). You will need to download and +install Boost. As of this writing Boost 1.55 is the current version. +You will need a compiled version of the boost libraries Boost.Test, +Boost.DateTime and Boost.Regex, or you will need to download +from source and build the library yourself. + +Unix users may be able to get pre-built packages with the following recipe: + +```bash +$ sudo add-apt-repository -y ppa:boost-latest/ppa +$ sudo apt-get -qq -d update +$ sudo apt-get -qq install libboost1.55-all-dev +``` + +Windows users can download compiled binaries from [sourceforge](http://sourceforge.net/projects/boost/files/boost-binaries/1.55.0-build2/). + +MacOS users can install boost with [Homebrew](http://brew.sh/) via +`brew install boost`. + +If all else fails you can download the source and build it yourself, +but you should prefer a prebuilt distribution to make things easier. +Bootstrap instructions are on the +[Boost getting started page](http://www.boost.org/doc/libs/release/more/getting_started/index.html). + +### Building the Exercises with CMake + +Each test file is meant to link against your implementation to provide a +console executable that runs the tests. The test executable prints messages +on failure and reports a non-zero exit status when tests fail. + +CMake 2.8.11 or later is recommended to simplify the procedure for any +environment and is a [free download](http://www.cmake.org/). +The solutions to the exercises were developed with the following CMake +recipe in the `cpp` directory. The recipe compiles and links the test +executable and runs it as part of the build. This makes failing tests +fail the build. In the following recipe, the `BOOST_INCLUDEDIR` variable +gives CMake a hint as to where it can find your Boost distribution. +You may need to edit this variable value to the appropriate location +on your system. + +``` +# cpp/CMakeLists.txt +cmake_minimum_required(VERSION 2.8.11) +project(exercism CXX) + +# TODO: a hint to the location of the Boost distribution on your system +# CMake may be able to locate your boost distribution without this. +# CMake always uses / as a path separator for this value, even on Windows. +set(BOOST_INCLUDEDIR D:/Code/boost/boost_1_55_0) + +set(Boost_USE_STATIC_LIBS ON) +set(Boost_USE_MULTITHREADED ON) +set(Boost_USE_STATIC_RUNTIME OFF) + +find_package(Boost 1.55 REQUIRED COMPONENTS unit_test_framework date_time regex) + +if(("${CMAKE_CXX_COMPILER_ID}" MATCHES "GNU") OR ("${CMAKE_CXX_COMPILER_ID}" MATCHES "Clang")) + set(CMAKE_CXX_FLAGS "-std=c++11") +endif() + +function(exercism exe) + string(REPLACE "-" "_" file ${exe}) + if(EXISTS ${CMAKE_CURRENT_SOURCE_DIR}/${file}.cpp) + set(exercise_cpp ${file}.cpp) + else() + set(exercise_cpp "") + endif() + add_executable(${exe} ${file}_test.cpp ${exercise_cpp} ${file}.h) + target_include_directories(${exe} PRIVATE ${Boost_INCLUDE_DIRS}) + target_link_libraries(${exe} ${Boost_LIBRARIES}) + add_custom_command(TARGET ${exe} POST_BUILD COMMAND ${exe}) +endfunction() + +foreach(exercise +# TODO: add the name of each exercise subdirectory here as you progress + bob +) + add_subdirectory(${exercise}) +endforeach() +``` + +Each exercise subdirectory has a `CMakeLists.txt` that invokes the `exercism` +function defined at the top-level: + +``` +# cpp/bob/CMakeLists.txt +exercism(bob) +``` + +This function combines *exercise*`.h`, *exercise*`.cpp` and *exercise*`_test.cpp` +where *exercise* is the name given to the `exercism()` CMake function. For +the example above, the files `bob.h`, `bob.cpp` and `bob_test.cpp` are combined +into a unit test executable. Your declarations of functions, classes, etc., +are in `bob.h`, definitions for your functions and classes are in `bob.cpp` +and the unit tests are in `bob_test.cpp`. +If your implementation is header-only, simply omit the *exercise*`.cpp` file, the CMake +recipe above will only include it in the build if the file exists. + +Using this recipe, CMake can generate a suitable project for your environment +by running `cmake -G` with a suitable generator and the location of the `cpp` +directory. Assuming the current directory is `cpp`, some examples are: +* Unix with make: `cmake -G "Unix Makefiles" .` +* Windows with Visual Studio 2013: `cmake -G "Visual Studio 12" .` +* MacOS with Xcode: `cmake -G Xcode`, or with make: `cmake -G "Unix Makefiles" .` + +### Boost.Test Documentation + +The Boost.Test documentation is being rewritten and is nearly complete. +Prefer the documentation rewrite to look up something if you're unfamiliar +with Boost.Test and want to know more. +* [Boost.Test 1.55 official documentation](http://www.boost.org/doc/libs/1_55_0/libs/test/doc/html/index.html) +* [Boost.Test documentation rewrite](http://user.xmission.com/~legalize/boost.test/) diff --git a/anagram/CMakeLists.txt b/anagram/CMakeLists.txt new file mode 100644 index 00000000..c6b32cb0 --- /dev/null +++ b/anagram/CMakeLists.txt @@ -0,0 +1 @@ +exercism(anagram) diff --git a/anagram/anagram_test.cpp b/anagram/anagram_test.cpp new file mode 100644 index 00000000..7fa7049a --- /dev/null +++ b/anagram/anagram_test.cpp @@ -0,0 +1,97 @@ +#include "anagram.h" +#define BOOST_TEST_MAIN +#include + +using namespace std; + +BOOST_AUTO_TEST_CASE(no_matches) +{ + auto subject = anagram::anagram("diaper"); + auto matches = subject.matches({"hello", "world", "zombies", "pants"}); + vector expected; + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), matches.begin(), matches.end()); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(detects_simple_anagram) +{ + auto subject = anagram::anagram("ant"); + auto matches = subject.matches({"tan", "stand", "at"}); + vector expected{"tan"}; + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), matches.begin(), matches.end()); +} + +BOOST_AUTO_TEST_CASE(does_not_detect_false_positives) +{ + auto subject = anagram::anagram("galea"); + auto matches = subject.matches({"eagle"}); + vector expected; + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), matches.begin(), matches.end()); +} + +BOOST_AUTO_TEST_CASE(detects_multiple_anagrams) +{ + auto subject = anagram::anagram("master"); + auto matches = subject.matches({"stream", "pigeon", "maters"}); + vector expected{"stream", "maters"}; + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), matches.begin(), matches.end()); +} + +BOOST_AUTO_TEST_CASE(does_not_detect_anagram_subsets) +{ + auto subject = anagram::anagram("good"); + auto matches = subject.matches({"dog", "goody"}); + vector expected; + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), matches.begin(), matches.end()); +} + +BOOST_AUTO_TEST_CASE(detects_anagram) +{ + auto subject = anagram::anagram("listen"); + auto matches = subject.matches({"enlists", "google", "inlets", "banana"}); + vector expected{"inlets"}; + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), matches.begin(), matches.end()); +} + +BOOST_AUTO_TEST_CASE(detects_multiple_anagrams2) +{ + auto subject = anagram::anagram("allergy"); + auto matches = subject.matches({"gallery", "ballerina", "regally", "clergy", "largely", "leading"}); + vector expected{"gallery", "regally", "largely"}; + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), matches.begin(), matches.end()); +} + +BOOST_AUTO_TEST_CASE(detects_anagrams_case_insensitively) +{ + auto subject = anagram::anagram("Orchestra"); + auto matches = subject.matches({"cashregister", "Carthorse", "radishes"}); + vector expected{"Carthorse"}; + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), matches.begin(), matches.end()); +} + +BOOST_AUTO_TEST_CASE(does_not_detect_a_word_as_its_own_anagram) +{ + auto subject = anagram::anagram("banana"); + auto matches = subject.matches({"Banana"}); + vector expected; + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), matches.begin(), matches.end()); +} + +BOOST_AUTO_TEST_CASE(matches_accepts_string_arguments) +{ + auto subject = anagram::anagram("ant"); + auto matches = subject.matches({"stand", "tan", "at"}); + vector expected{"tan"}; + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), matches.begin(), matches.end()); +} +#endif diff --git a/anagram/example.cpp b/anagram/example.cpp new file mode 100644 index 00000000..55458244 --- /dev/null +++ b/anagram/example.cpp @@ -0,0 +1,49 @@ +#include "anagram.h" +#include +#include +#include + +using namespace std; + +namespace +{ + +string to_lower(std::string const& s) +{ + string result{s}; + boost::to_lower(result); + return result; +} + +string make_key(std::string const& s) +{ + string key{to_lower(s)}; + sort(key.begin(), key.end()); + return key; +} + +} + +namespace anagram +{ + +anagram::anagram(string const& subject) + : subject_(subject), + key_(make_key(subject)) +{ +} + +vector anagram::matches(vector const& matches) +{ + vector result; + for (string const& s : matches) { + if (s.length() == key_.length() + && to_lower(s) != to_lower(subject_) + && make_key(s) == key_) { + result.push_back(s); + } + } + return result; +} + +} diff --git a/anagram/example.h b/anagram/example.h new file mode 100644 index 00000000..cb1f8aa8 --- /dev/null +++ b/anagram/example.h @@ -0,0 +1,24 @@ +#if !defined(ANAGRAM_H) +#define ANAGRAM_H + +#include +#include + +namespace anagram +{ + +class anagram +{ +public: + anagram(std::string const& subject); + + std::vector matches(std::vector const& matches); + +private: + std::string const subject_; + std::string const key_; +}; + +} + +#endif diff --git a/beer-song/CMakeLists.txt b/beer-song/CMakeLists.txt new file mode 100644 index 00000000..0ef610b2 --- /dev/null +++ b/beer-song/CMakeLists.txt @@ -0,0 +1 @@ +exercism(beer-song) diff --git a/beer-song/beer_song_test.cpp b/beer-song/beer_song_test.cpp new file mode 100644 index 00000000..419c129d --- /dev/null +++ b/beer-song/beer_song_test.cpp @@ -0,0 +1,62 @@ +#include "beer_song.h" +#define BOOST_TEST_MAIN +#include + +using namespace std; + +BOOST_AUTO_TEST_CASE(prints_an_arbitrary_verse) +{ + string expected = "8 bottles of beer on the wall, 8 bottles of beer.\n" + "Take one down and pass it around, 7 bottles of beer on the wall.\n"; + + BOOST_REQUIRE_EQUAL(expected, beer::verse(8)); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(handles_1_bottle) +{ + string expected = "1 bottle of beer on the wall, 1 bottle of beer.\n" + "Take it down and pass it around, no more bottles of beer on the wall.\n"; + + BOOST_REQUIRE_EQUAL(expected, beer::verse(1)); +} + +BOOST_AUTO_TEST_CASE(handles_0_bottles) +{ + string expected = "No more bottles of beer on the wall, no more bottles of beer.\n" + "Go to the store and buy some more, 99 bottles of beer on the wall.\n"; + + BOOST_REQUIRE_EQUAL(expected, beer::verse(0)); +} + +BOOST_AUTO_TEST_CASE(sings_several_verses) +{ + string expected = "8 bottles of beer on the wall, 8 bottles of beer.\n" + "Take one down and pass it around, 7 bottles of beer on the wall.\n" + "\n" + "7 bottles of beer on the wall, 7 bottles of beer.\n" + "Take one down and pass it around, 6 bottles of beer on the wall.\n" + "\n" + "6 bottles of beer on the wall, 6 bottles of beer.\n" + "Take one down and pass it around, 5 bottles of beer on the wall.\n"; + + BOOST_REQUIRE_EQUAL(expected, beer::sing(8, 6)); +} + +BOOST_AUTO_TEST_CASE(sings_the_rest_of_the_verses) +{ + string expected = "3 bottles of beer on the wall, 3 bottles of beer.\n" + "Take one down and pass it around, 2 bottles of beer on the wall.\n" + "\n" + "2 bottles of beer on the wall, 2 bottles of beer.\n" + "Take one down and pass it around, 1 bottle of beer on the wall.\n" + "\n" + "1 bottle of beer on the wall, 1 bottle of beer.\n" + "Take it down and pass it around, no more bottles of beer on the wall.\n" + "\n" + "No more bottles of beer on the wall, no more bottles of beer.\n" + "Go to the store and buy some more, 99 bottles of beer on the wall.\n"; + + BOOST_REQUIRE_EQUAL(expected, beer::sing(3)); +} +#endif diff --git a/beer-song/example.cpp b/beer-song/example.cpp new file mode 100644 index 00000000..5f64f3ad --- /dev/null +++ b/beer-song/example.cpp @@ -0,0 +1,83 @@ +#include "beer_song.h" +#include + +using namespace std; + +namespace beer +{ + +namespace +{ + +struct bottles +{ + bottles(unsigned num) + : count(num), + suffix(num > 1 ? "s" : "") + {} + unsigned const count; + string const suffix; +}; + +ostream& operator<<(ostream& stream, bottles const& b) +{ + if (b.count) { + stream << b.count << " bottle" << b.suffix; + } else { + stream << "no more bottles"; + } + return stream << " of beer"; +} + +void bottles_of_beer_on_the_wall(ostream& stream, unsigned count) +{ + if (count) { + stream << bottles(count) << " on the wall, " << bottles(count) << ".\n"; + } else { + stream << "No more bottles of beer on the wall, " << bottles(count) << ".\n"; + } +} + +void take_one_down_and_pass_it_around(ostream& stream, unsigned count) +{ + if (count > 1) { + stream << "Take one down and pass it around, " << bottles(count - 1) << " on the wall.\n"; + } else if (count) { + stream << "Take it down and pass it around, " << bottles(count - 1) << " on the wall.\n"; + } else { + stream << "Go to the store and buy some more, 99 bottles of beer on the wall.\n"; + } +} + +void verse(ostream& stream, unsigned count) +{ + bottles_of_beer_on_the_wall(stream, count); + take_one_down_and_pass_it_around(stream, count); +} + +} + +extern string verse(unsigned num) +{ + ostringstream stream; + verse(stream, num); + return stream.str(); +} + +extern string sing(unsigned begin, unsigned end) +{ + ostringstream stream; + for (unsigned num = begin; num > end; --num) { + verse(stream, num); + stream << '\n'; + } + verse(stream, end); + return stream.str(); +} + +extern string sing(unsigned num) +{ + return sing(num, 0); +} + +} diff --git a/beer-song/example.h b/beer-song/example.h new file mode 100644 index 00000000..b2c86937 --- /dev/null +++ b/beer-song/example.h @@ -0,0 +1,15 @@ +#if !defined(BEER_SONG_H) +#define BEER_SONG_H + +#include + +namespace beer +{ + +extern std::string verse(unsigned bottles); +extern std::string sing(unsigned begin, unsigned end); +extern std::string sing(unsigned bottles); + +} + +#endif diff --git a/bob/CMakeLists.txt b/bob/CMakeLists.txt new file mode 100644 index 00000000..ba93413a --- /dev/null +++ b/bob/CMakeLists.txt @@ -0,0 +1 @@ +exercism(bob) diff --git a/bob/bob_test.cpp b/bob/bob_test.cpp new file mode 100644 index 00000000..35faf8bb --- /dev/null +++ b/bob/bob_test.cpp @@ -0,0 +1,80 @@ +#include "bob.h" +#define BOOST_TEST_MAIN +#include + +BOOST_AUTO_TEST_CASE(stating_something) +{ + BOOST_REQUIRE_EQUAL("Whatever.", bob::hey("Tom-ay-to, tom-aaaah-to.")); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(shouting) +{ + BOOST_REQUIRE_EQUAL("Woah, chill out!", bob::hey("WATCH OUT!")); +} + +BOOST_AUTO_TEST_CASE(asking_a_question) +{ + BOOST_REQUIRE_EQUAL("Sure.", bob::hey("Does this cryogenic chamber make me look fat?")); +} + +BOOST_AUTO_TEST_CASE(talking_forcefully) +{ + BOOST_REQUIRE_EQUAL("Whatever.", bob::hey("Let's go make out behind the gym!")); +} + +BOOST_AUTO_TEST_CASE(using_acronyms_in_regular_speech) +{ + BOOST_REQUIRE_EQUAL("Whatever.", bob::hey("It's OK if you don't want to go to the DMV.")); +} + +BOOST_AUTO_TEST_CASE(forceful_questions) +{ + BOOST_REQUIRE_EQUAL("Woah, chill out!", bob::hey("WHAT THE HELL WERE YOU THINKING?")); +} + +BOOST_AUTO_TEST_CASE(shouting_numbers) +{ + BOOST_REQUIRE_EQUAL("Woah, chill out!", bob::hey("1, 2, 3 GO!")); +} + +BOOST_AUTO_TEST_CASE(only_numbers) +{ + BOOST_REQUIRE_EQUAL("Whatever.", bob::hey("1, 2, 3")); +} + +BOOST_AUTO_TEST_CASE(question_with_only_numbers) +{ + BOOST_REQUIRE_EQUAL("Sure.", bob::hey("4?")); +} + +BOOST_AUTO_TEST_CASE(shouting_with_special_characters) +{ + BOOST_REQUIRE_EQUAL("Woah, chill out!", bob::hey("ZOMG THE %^*@#$(*^ ZOMBIES ARE COMING!!11!!1!")); +} + +BOOST_AUTO_TEST_CASE(shouting_with_no_exclamation_mark) +{ + BOOST_REQUIRE_EQUAL("Woah, chill out!", bob::hey("I HATE YOU")); +} + +BOOST_AUTO_TEST_CASE(statement_containing_question_mark) +{ + BOOST_REQUIRE_EQUAL("Whatever.", bob::hey("Ending with a ? means a question.")); +} + +BOOST_AUTO_TEST_CASE(prattling_on) +{ + BOOST_REQUIRE_EQUAL("Sure.", bob::hey("Wait! Hang on. Are you going to be OK?")); +} + +BOOST_AUTO_TEST_CASE(silence) +{ + BOOST_REQUIRE_EQUAL("Fine. Be that way!", bob::hey("")); +} + +BOOST_AUTO_TEST_CASE(prolonged_silence) +{ + BOOST_REQUIRE_EQUAL("Fine. Be that way!", bob::hey(" ")); +} +#endif diff --git a/bob/example.cpp b/bob/example.cpp new file mode 100644 index 00000000..7cf40004 --- /dev/null +++ b/bob/example.cpp @@ -0,0 +1,77 @@ +#include "bob.h" +#include +#include +#include + +using namespace std; + +namespace bob +{ +namespace +{ + +const char upper_case_a_umlaut = '\xc4'; +const char upper_case_u_umlaut = '\xdc'; + +bool is_upper(string const& text) +{ + auto last = end(text); + auto it = find_if_not(begin(text), last, [](char c) { + if (c < 0 || c > 127) { + return c == upper_case_a_umlaut + || c == upper_case_u_umlaut; + } + return c == toupper(c); + }); + return it == last; +} + +bool has_alpha(string const& text) +{ + auto last = end(text); + auto it = find_if(begin(text), last, [](char c) { return c < 0 || c > 127 || isalpha(c); }); + return it != last; +} + +string trim(string const& text) +{ + auto first = text.find_first_not_of(' '); + if (first == string::npos) { + return string(); + } + auto last = text.find_last_not_of(' '); + return string(&text[first], &text[last]); +} + +bool is_shouting(string const &text) +{ + return is_upper(text) && has_alpha(text); +} + +bool is_question(string const &text) +{ + return text.back() == '?'; +} + +bool is_silence(string const& text) +{ + return trim(text).length() == 0; +} + +} + +string hey(string const& text) +{ + if (is_silence(text)) { + return "Fine. Be that way!"; + } + if (is_shouting(text)) { + return "Woah, chill out!"; + } + if (is_question(text)) { + return "Sure."; + } + return "Whatever."; +} + +} diff --git a/bob/example.h b/bob/example.h new file mode 100644 index 00000000..5a3cd4a3 --- /dev/null +++ b/bob/example.h @@ -0,0 +1,12 @@ +#if !defined(BOB_H) +#define BOB_H + +#include + +namespace bob { + +extern std::string hey(std::string const& text); + +} + +#endif diff --git a/clock/CMakeLists.txt b/clock/CMakeLists.txt new file mode 100644 index 00000000..6f05bd7c --- /dev/null +++ b/clock/CMakeLists.txt @@ -0,0 +1 @@ +exercism(clock) diff --git a/clock/clock_test.cpp b/clock/clock_test.cpp new file mode 100644 index 00000000..1a39b81f --- /dev/null +++ b/clock/clock_test.cpp @@ -0,0 +1,84 @@ +#include "clock.h" +#define BOOST_TEST_MAIN +#include + +using namespace std; + +BOOST_AUTO_TEST_CASE(prints_the_hour) +{ + BOOST_REQUIRE_EQUAL("08:00", string(date_independent::clock::at(8))); + BOOST_REQUIRE_EQUAL("09:00", string(date_independent::clock::at(9))); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(prints_past_the_hour) +{ + BOOST_REQUIRE_EQUAL("11:09", string(date_independent::clock::at(11, 9))); + BOOST_REQUIRE_EQUAL("11:19", string(date_independent::clock::at(11, 19))); +} + +BOOST_AUTO_TEST_CASE(can_add_minutes) +{ + const auto clock = date_independent::clock::at(10).plus(3); + + BOOST_REQUIRE_EQUAL("10:03", string(clock)); +} + +BOOST_AUTO_TEST_CASE(can_add_over_an_hour) +{ + const auto clock = date_independent::clock::at(10).plus(61); + + BOOST_REQUIRE_EQUAL("11:01", string(clock)); +} + +BOOST_AUTO_TEST_CASE(wraps_around_midnight) +{ + const auto clock = date_independent::clock::at(23, 59).plus(2); + + BOOST_REQUIRE_EQUAL("00:01", string(clock)); +} + +BOOST_AUTO_TEST_CASE(can_subtract_minutes) +{ + const auto clock = date_independent::clock::at(10, 3).minus(3); + + BOOST_REQUIRE_EQUAL("10:00", string(clock)); +} + +BOOST_AUTO_TEST_CASE(can_subtract_to_previous_hour) +{ + const auto clock = date_independent::clock::at(10, 3).minus(30); + + BOOST_REQUIRE_EQUAL("09:33", string(clock)); +} + +BOOST_AUTO_TEST_CASE(can_subtract_over_an_hour) +{ + const auto clock = date_independent::clock::at(10, 3).minus(70); + + BOOST_REQUIRE_EQUAL("08:53", string(clock)); +} + +BOOST_AUTO_TEST_CASE(can_know_if_its_equal_to_another_clock) +{ + const auto clock1 = date_independent::clock::at(10, 3); + const auto clock2 = date_independent::clock::at(10, 3); + + BOOST_REQUIRE(clock1 == clock2); +} + +BOOST_AUTO_TEST_CASE(can_know_if_its_not_equal_to_another_clock) +{ + const auto clock1 = date_independent::clock::at(10, 3); + const auto clock2 = date_independent::clock::at(10, 4); + + BOOST_REQUIRE(clock1 != clock2); +} + +BOOST_AUTO_TEST_CASE(wraps_around_midnight_backwards) +{ + const auto clock = date_independent::clock::at(0, 3).minus(4); + + BOOST_REQUIRE_EQUAL("23:59", string(clock)); +} +#endif diff --git a/clock/example.cpp b/clock/example.cpp new file mode 100644 index 00000000..f8a6bd6e --- /dev/null +++ b/clock/example.cpp @@ -0,0 +1,58 @@ +#include "clock.h" +#include +#include + +using namespace std; + +namespace date_independent +{ + +clock& clock::plus(int minutes) +{ + minute_ += minutes; + if (minute_ > 60) { + hour_ += (minute_/60); + hour_ %= 24; + minute_ %= 60; + } + return *this; +} + +clock& clock::minus(int minutes) +{ + minute_ -= minutes; + while (minute_ < 0) { + --hour_; + minute_ += 60; + } + while (hour_ < 0) { + hour_ += 24; + } + return *this; +} + +clock::operator string() const +{ + ostringstream str; + str << setw(2) << setfill('0') << hour_ << ':' << setw(2) << setfill('0') << minute_; + return str.str(); +} + +clock::clock(int hour, int minute) + : hour_(hour), + minute_(minute) +{ +} + +clock clock::at(int hour, int minute /*= 0*/) +{ + return clock(hour, minute); +} + +bool clock::operator==(const clock& rhs) const +{ + return hour_ == rhs.hour_ + && minute_ == rhs.minute_; +} + +} diff --git a/clock/example.h b/clock/example.h new file mode 100644 index 00000000..5214769c --- /dev/null +++ b/clock/example.h @@ -0,0 +1,34 @@ +#if !defined(CLOCK_H) +#define CLOCK_H + +#include + +namespace date_independent +{ + +class clock +{ +public: + static clock at(int hour, int minute = 0); + + clock& plus(int minutes); + clock& minus(int minutes); + + operator std::string() const; + + bool operator==(const clock& rhs) const; + +private: + clock(int hour, int minute); + int hour_; + int minute_; +}; + +inline bool operator!=(const clock& lhs, const clock& rhs) +{ + return !(lhs == rhs); +} + +} + +#endif diff --git a/config.json b/config.json index 3c44a645..29aecd08 100644 --- a/config.json +++ b/config.json @@ -4,10 +4,27 @@ "repository": "https://github.com/exercism/xcpp", "active": false, "problems": [ - + "bob", + "word-count", + "hamming", + "anagram", + "food-chain", + "beer-song", + "nucleotide-count", + "rna-transcription", + "phone-number", + "grade-school", + "robot-name", + "leap", + "etl", + "space-age", + "grains", + "gigasecond", + "triangle", + "clock" ], "deprecated": [ - + "point-mutations" ], "ignored": [ diff --git a/etl/CMakeLists.txt b/etl/CMakeLists.txt new file mode 100644 index 00000000..8ba83429 --- /dev/null +++ b/etl/CMakeLists.txt @@ -0,0 +1 @@ +exercism(etl) diff --git a/etl/etl_test.cpp b/etl/etl_test.cpp new file mode 100644 index 00000000..9babffde --- /dev/null +++ b/etl/etl_test.cpp @@ -0,0 +1,76 @@ +#include "etl.h" +#define BOOST_TEST_MAIN +#include + +namespace boost +{ + +// teach Boost.Test how to print std::pair +template +inline wrap_stringstream& +operator<<(wrap_stringstream& wrapped, std::pair const& item) +{ + return wrapped << '<' << item.first << ',' << item.second << '>'; +} + +} + +#define REQUIRE_EQUAL_CONTAINERS(left_, right_) \ + BOOST_REQUIRE_EQUAL_COLLECTIONS(left_.begin(), left_.end(), right_.begin(), right_.end()) + +BOOST_AUTO_TEST_CASE(transforms_one_value) +{ + const std::map> old{{1, {'A'}}}; + + const auto actual = etl::transform(old); + + const std::map expected{{'a', 1}}; + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(transforms_more_values) +{ + const std::map> old{{1, {'A', 'E', 'I', 'O', 'U'}}}; + + const auto actual = etl::transform(old); + + const std::map expected{{'a', 1}, {'e', 1}, {'i', 1}, {'o', 1}, {'u', 1}}; + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(transforms_more_keys) +{ + const std::map> old{{1, {'A', 'E'}}, {2, {'D', 'G'}}}; + + const auto actual = etl::transform(old); + + const std::map expected{{'a', 1}, {'e', 1}, {'d', 2}, {'g', 2}}; + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(transforms_a_full_dataset) +{ + const std::map> old{ + {1, {'A', 'E', 'I', 'O', 'U', 'L', 'N', 'R', 'S', 'T'}}, + {2, {'D', 'G'}}, + {3, {'B', 'C', 'M', 'P'}}, + {4, {'F', 'H', 'V', 'W', 'Y'}}, + {5, {'K'}}, + {8, {'J', 'X'}}, + {10, {'Q', 'Z'}} + }; + + const auto actual = etl::transform(old); + + const std::map expected{ + {'a', 1}, {'b', 3}, {'c', 3}, {'d', 2}, {'e', 1}, + {'f', 4}, {'g', 2}, {'h', 4}, {'i', 1}, {'j', 8}, + {'k', 5}, {'l', 1}, {'m', 3}, {'n', 1}, {'o', 1}, + {'p', 3}, {'q', 10}, {'r', 1}, {'s', 1}, {'t', 1}, + {'u', 1}, {'v', 4}, {'w', 4}, {'x', 8}, {'y', 4}, + {'z', 10} + }; + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} +#endif diff --git a/etl/example.cpp b/etl/example.cpp new file mode 100644 index 00000000..ddad82f2 --- /dev/null +++ b/etl/example.cpp @@ -0,0 +1,20 @@ +#include "etl.h" +#include + +using namespace std; + +namespace etl +{ + +extern map transform(map> const& old) +{ + map result; + for (auto const& item : old) { + for (char c : item.second) { + result[tolower(c)] = item.first; + } + } + return result; +} + +} diff --git a/etl/example.h b/etl/example.h new file mode 100644 index 00000000..f53b162a --- /dev/null +++ b/etl/example.h @@ -0,0 +1,14 @@ +#if !defined(ETL_H) +#define ETL_H + +#include +#include + +namespace etl +{ + +extern std::map transform(std::map> const& old); + +} + +#endif diff --git a/food-chain/CMakeLists.txt b/food-chain/CMakeLists.txt new file mode 100644 index 00000000..87b5fd11 --- /dev/null +++ b/food-chain/CMakeLists.txt @@ -0,0 +1 @@ +exercism(food-chain) diff --git a/food-chain/example.cpp b/food-chain/example.cpp new file mode 100644 index 00000000..f694ee5a --- /dev/null +++ b/food-chain/example.cpp @@ -0,0 +1,112 @@ +#include "food_chain.h" + +using namespace std; + +namespace food_chain +{ + +namespace +{ + +class song_verse +{ +public: + song_verse(string f, string r, string v) + : food_(f), + reaction_(r), + verse_(v) + {} + + string sing() const + { + return "I know an old lady who swallowed a " + food_ + ".\n" + + reaction_ + verse_; + } + + string verse() const + { + return verse_; + } + +private: + string food_; + string reaction_; + string verse_; +}; + +song_verse const song_verses[] = +{ + { + "fly", + "", + "I don't know why she swallowed the fly. Perhaps she'll die.\n" + }, + { + "spider", + "It wriggled and jiggled and tickled inside her.\n", + "She swallowed the spider to catch the fly.\n" + }, + { + "bird", + "How absurd to swallow a bird!\n", + "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.\n" + }, + { + "cat", + "Imagine that, to swallow a cat!\n", + "She swallowed the cat to catch the bird.\n" + }, + { + "dog", + "What a hog, to swallow a dog!\n", + "She swallowed the dog to catch the cat.\n" + }, + { + "goat", + "Just opened her throat and swallowed a goat!\n", + "She swallowed the goat to catch the dog.\n" + }, + { + "cow", + "I don't know how she swallowed a cow!\n", + "She swallowed the cow to catch the goat.\n" + }, + { + "horse", + "", + "She's dead, of course!\n" + } +}; + +} + +extern string verse(unsigned num) +{ + if (num > 0 && num <= 8) { + --num; + string text = song_verses[num].sing(); + if (num < 7) { + while (num--) { + text += song_verses[num].verse(); + } + } + return text; + } + return ""; +} + +extern string verses(unsigned begin, unsigned end) +{ + string text; + for (unsigned v = begin; v <= end; ++v) { + text += verse(v) + "\n"; + } + return text; +} + +extern string sing() +{ + return verses(1, 8); +} + +} diff --git a/food-chain/example.h b/food-chain/example.h new file mode 100644 index 00000000..20247b64 --- /dev/null +++ b/food-chain/example.h @@ -0,0 +1,15 @@ +#if !defined(FOOD_CHAIN_H) +#define FOOD_CHAIN_H + +#include + +namespace food_chain +{ + +extern std::string verse(unsigned which); +extern std::string verses(unsigned begin, unsigned end); +extern std::string sing(); + +} + +#endif diff --git a/food-chain/food_chain_test.cpp b/food-chain/food_chain_test.cpp new file mode 100644 index 00000000..af652d32 --- /dev/null +++ b/food-chain/food_chain_test.cpp @@ -0,0 +1,122 @@ +#include "food_chain.h" +#define BOOST_TEST_MAIN +#include + +using namespace std; + +BOOST_AUTO_TEST_CASE(fly) +{ + string expected = "I know an old lady who swallowed a fly.\n" + "I don't know why she swallowed the fly. Perhaps she'll die.\n"; + + BOOST_REQUIRE_EQUAL(expected, food_chain::verse(1)); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(spider) +{ + string expected = "I know an old lady who swallowed a spider.\n" + "It wriggled and jiggled and tickled inside her.\n" + "She swallowed the spider to catch the fly.\n" + "I don't know why she swallowed the fly. Perhaps she'll die.\n"; + + BOOST_REQUIRE_EQUAL(expected, food_chain::verse(2)); +} + +BOOST_AUTO_TEST_CASE(bird) +{ + string expected = "I know an old lady who swallowed a bird.\n" + "How absurd to swallow a bird!\n" + "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.\n" + "She swallowed the spider to catch the fly.\n" + "I don't know why she swallowed the fly. Perhaps she'll die.\n"; + + BOOST_REQUIRE_EQUAL(expected, food_chain::verse(3)); +} + +BOOST_AUTO_TEST_CASE(cat) +{ + string expected = "I know an old lady who swallowed a cat.\n" + "Imagine that, to swallow a cat!\n" + "She swallowed the cat to catch the bird.\n" + "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.\n" + "She swallowed the spider to catch the fly.\n" + "I don't know why she swallowed the fly. " + "Perhaps she'll die.\n"; + + BOOST_REQUIRE_EQUAL(expected, food_chain::verse(4)); +} + +BOOST_AUTO_TEST_CASE(dog) +{ + string expected = "I know an old lady who swallowed a dog.\n" + "What a hog, to swallow a dog!\n" + "She swallowed the dog to catch the cat.\n" + "She swallowed the cat to catch the bird.\n" + "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.\n" + "She swallowed the spider to catch the fly.\n" + "I don't know why she swallowed the fly. " + "Perhaps she'll die.\n"; + + BOOST_REQUIRE_EQUAL(expected, food_chain::verse(5)); +} + +BOOST_AUTO_TEST_CASE(goat) +{ + string expected = "I know an old lady who swallowed a goat.\n" + "Just opened her throat and swallowed a goat!\n" + "She swallowed the goat to catch the dog.\n" + "She swallowed the dog to catch the cat.\n" + "She swallowed the cat to catch the bird.\n" + "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.\n" + "She swallowed the spider to catch the fly.\n" + "I don't know why she swallowed the fly. " + "Perhaps she'll die.\n"; + + BOOST_REQUIRE_EQUAL(expected, food_chain::verse(6)); +} + +BOOST_AUTO_TEST_CASE(cow) +{ + string expected = "I know an old lady who swallowed a cow.\n" + "I don't know how she swallowed a cow!\n" + "She swallowed the cow to catch the goat.\n" + "She swallowed the goat to catch the dog.\n" + "She swallowed the dog to catch the cat.\n" + "She swallowed the cat to catch the bird.\n" + "She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.\n" + "She swallowed the spider to catch the fly.\n" + "I don't know why she swallowed the fly. " + "Perhaps she'll die.\n"; + + BOOST_REQUIRE_EQUAL(expected, food_chain::verse(7)); +} + +BOOST_AUTO_TEST_CASE(horse) +{ + string expected = "I know an old lady who swallowed a horse.\n" + "She's dead, of course!\n"; + + BOOST_REQUIRE_EQUAL(expected, food_chain::verse(8)); +} + +BOOST_AUTO_TEST_CASE(multiple_verses) +{ + string expected = + "I know an old lady who swallowed a fly.\n" + "I don't know why she swallowed the fly. Perhaps she'll die.\n" + "\n" + "I know an old lady who swallowed a spider.\n" + "It wriggled and jiggled and tickled inside her.\n" + "She swallowed the spider to catch the fly.\n" + "I don't know why she swallowed the fly. Perhaps she'll die.\n" + "\n"; + + BOOST_REQUIRE_EQUAL(expected, food_chain::verses(1, 2)); +} + +BOOST_AUTO_TEST_CASE(the_whole_song) +{ + BOOST_REQUIRE_EQUAL(food_chain::verses(1, 8), food_chain::sing()); +} +#endif diff --git a/gigasecond/CMakeLists.txt b/gigasecond/CMakeLists.txt new file mode 100644 index 00000000..3ffbfbbf --- /dev/null +++ b/gigasecond/CMakeLists.txt @@ -0,0 +1 @@ +exercism(gigasecond) diff --git a/gigasecond/example.cpp b/gigasecond/example.cpp new file mode 100644 index 00000000..ef22f500 --- /dev/null +++ b/gigasecond/example.cpp @@ -0,0 +1,15 @@ +#include "gigasecond.h" + +namespace gigasecond +{ + +extern boost::gregorian::date advance(const boost::gregorian::date& start) +{ + const unsigned long long seconds_per_minute = 60; + const unsigned long long seconds_per_hour = 60*seconds_per_minute; + const unsigned long long seconds_per_day = 24*seconds_per_hour; + const unsigned long long one_giga_second = 1000000000; + return start + boost::gregorian::days(one_giga_second/seconds_per_day); +} + +} diff --git a/gigasecond/example.h b/gigasecond/example.h new file mode 100644 index 00000000..594b4420 --- /dev/null +++ b/gigasecond/example.h @@ -0,0 +1,13 @@ +#if !defined(GIGASECOND_H) +#define GIGASECOND_H + +#include + +namespace gigasecond +{ + +extern boost::gregorian::date advance(const boost::gregorian::date& start); + +} + +#endif diff --git a/gigasecond/gigasecond_test.cpp b/gigasecond/gigasecond_test.cpp new file mode 100644 index 00000000..79cb4522 --- /dev/null +++ b/gigasecond/gigasecond_test.cpp @@ -0,0 +1,32 @@ +#include "gigasecond.h" +#define BOOST_TEST_MAIN +#include + +// See +// for documentation on boost::gregorian::date + +BOOST_AUTO_TEST_CASE(test_1) +{ + const auto actual = gigasecond::advance(boost::gregorian::date(2011, 4, 26)); + + const boost::gregorian::date expected(2043, 1, 2); + BOOST_REQUIRE_EQUAL(expected, actual); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(test_2) +{ + const auto actual = gigasecond::advance(boost::gregorian::date(1977, 6, 14)); + + const boost::gregorian::date expected(2009, 2, 20); + BOOST_REQUIRE_EQUAL(expected, actual); +} + +BOOST_AUTO_TEST_CASE(test_3) +{ + const auto actual = gigasecond::advance(boost::gregorian::date(1959, 7, 20)); + + const boost::gregorian::date expected(1991, 3, 28); + BOOST_REQUIRE_EQUAL(expected, actual); +} +#endif diff --git a/grade-school/CMakeLists.txt b/grade-school/CMakeLists.txt new file mode 100644 index 00000000..c7bf334d --- /dev/null +++ b/grade-school/CMakeLists.txt @@ -0,0 +1 @@ +exercism(grade-school) diff --git a/grade-school/example.cpp b/grade-school/example.cpp new file mode 100644 index 00000000..8ec53214 --- /dev/null +++ b/grade-school/example.cpp @@ -0,0 +1,26 @@ +#include "grade_school.h" +#include + +using namespace std; + +namespace grade_school +{ + +void school::add(string const& name, int grade) +{ + vector& grade_roster = roster_[grade]; + auto it = lower_bound(grade_roster.begin(), grade_roster.end(), name); + if (it == grade_roster.end()) { + grade_roster.push_back(name); + } else { + grade_roster.insert(it, name); + } +} + +vector school::grade(int grade) const +{ + auto it = roster_.find(grade); + return (it != roster_.end()) ? it->second : vector{}; +} + +} diff --git a/grade-school/example.h b/grade-school/example.h new file mode 100644 index 00000000..9a6baf69 --- /dev/null +++ b/grade-school/example.h @@ -0,0 +1,28 @@ +#if !defined(GRADE_SCHOOL_H) +#define GRADE_SCHOOL_H + +#include +#include +#include + +namespace grade_school +{ + +class school +{ +public: + const std::map>& roster() const { + return roster_; + } + + void add(std::string const& name, int grade); + + std::vector grade(int grade) const; + +private: + std::map> roster_; +}; + +} + +#endif diff --git a/grade-school/grade_school_test.cpp b/grade-school/grade_school_test.cpp new file mode 100644 index 00000000..557e2970 --- /dev/null +++ b/grade-school/grade_school_test.cpp @@ -0,0 +1,120 @@ +#include "grade_school.h" +#define BOOST_TEST_MAIN +#include + +namespace boost +{ + +// teach Boost.Test how to print std::vector +template +inline wrap_stringstream& +operator<<(wrap_stringstream& wrapped, std::vector const& item) +{ + wrapped << '['; + bool first = true; + for (auto const& element : item) { + wrapped << (!first ? "," : "") << element; + first = false; + } + return wrapped << ']'; +} + +// teach Boost.Test how to print std::pair +template +inline wrap_stringstream& +operator<<(wrap_stringstream& wrapped, std::pair const& item) +{ + return wrapped << '<' << item.first << ',' << item.second << '>'; +} + +} + +#define REQUIRE_EQUAL_CONTAINERS(left_, right_) \ + BOOST_REQUIRE_EQUAL_COLLECTIONS(left_.begin(), left_.end(), right_.begin(), right_.end()) + +using namespace std; + +struct school_fixture +{ + grade_school::school school_; +}; + +BOOST_FIXTURE_TEST_SUITE(school_suite, school_fixture); + +BOOST_AUTO_TEST_CASE(a_new_school_has_an_empty_roster) +{ + BOOST_REQUIRE(school_.roster().empty()); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(adding_a_student_adds_them_to_the_roster_for_the_given_grade) +{ + school_.add("Aimee", 2); + + const auto actual = school_.roster(); + + const map> expected{{2, {"Aimee"}}}; + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(adding_more_students_to_the_same_grade_adds_them_to_the_roster) +{ + school_.add("Blair", 2); + school_.add("James", 2); + school_.add("Paul", 2); + + const auto actual = school_.roster(); + + const map> expected{{2, {"Blair", "James", "Paul"}}}; + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(adding_students_to_different_grades_adds_them_to_the_roster) +{ + school_.add("Chelsea", 3); + school_.add("Logan", 7); + + const auto actual = school_.roster(); + + const map> expected{{3, {"Chelsea"}}, {7, {"Logan"}}}; + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(grade_returns_the_students_in_that_grade_in_alphabetical_order) +{ + school_.add("Franklin", 5); + school_.add("Bradley", 5); + school_.add("Jeff", 1); + + const auto actual = school_.grade(5); + + const vector expected{"Bradley", "Franklin"}; + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(grade_returns_an_empty_array_if_there_are_no_students_in_that_grade) +{ + const auto actual = school_.grade(1); + + BOOST_REQUIRE(actual.empty()); +} + +BOOST_AUTO_TEST_CASE(the_student_names_in_each_grade_in_the_roster_are_sorted) +{ + school_.add("Jennifer", 4); + school_.add("Kareem", 6); + school_.add("Christopher", 4); + school_.add("Kyle", 3); + + const auto actual = school_.roster(); + + const map> expected{ + {3, {"Kyle"}}, + {4, {"Christopher", "Jennifer"}}, + {6, {"Kareem"}} + }; + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} +#endif + +BOOST_AUTO_TEST_SUITE_END(); diff --git a/grains/CMakeLists.txt b/grains/CMakeLists.txt new file mode 100644 index 00000000..8fe3d5fe --- /dev/null +++ b/grains/CMakeLists.txt @@ -0,0 +1 @@ +exercism(grains) diff --git a/grains/example.cpp b/grains/example.cpp new file mode 100644 index 00000000..1b044665 --- /dev/null +++ b/grains/example.cpp @@ -0,0 +1,20 @@ +#include "grains.h" + +namespace grains +{ + +extern unsigned long long square(int which) +{ + return 1ULL << (which-1); +} + +extern unsigned long long total() +{ + unsigned long long result = 0; + for (int i = 1; i <= 64; ++i) { + result += square(i); + } + return result; +} + +} diff --git a/grains/example.h b/grains/example.h new file mode 100644 index 00000000..006ba871 --- /dev/null +++ b/grains/example.h @@ -0,0 +1,13 @@ +#if !defined(GRAINS_H) +#define GRAINS_H + +namespace grains +{ + +extern unsigned long long square(int which); + +extern unsigned long long total(); + +} + +#endif diff --git a/grains/grains_test.cpp b/grains/grains_test.cpp new file mode 100644 index 00000000..fa5a3a82 --- /dev/null +++ b/grains/grains_test.cpp @@ -0,0 +1,45 @@ +#include "grains.h" +#define BOOST_TEST_MAIN +#include + +BOOST_AUTO_TEST_CASE(square_1) +{ + BOOST_REQUIRE_EQUAL(1ULL, grains::square(1)); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(square_2) +{ + BOOST_REQUIRE_EQUAL(2ULL, grains::square(2)); +} + +BOOST_AUTO_TEST_CASE(square_3) +{ + BOOST_REQUIRE_EQUAL(4ULL, grains::square(3)); +} + +BOOST_AUTO_TEST_CASE(square_4) +{ + BOOST_REQUIRE_EQUAL(8ULL, grains::square(4)); +} + +BOOST_AUTO_TEST_CASE(square_16) +{ + BOOST_REQUIRE_EQUAL(32768ULL, grains::square(16)); +} + +BOOST_AUTO_TEST_CASE(square_32) +{ + BOOST_REQUIRE_EQUAL(2147483648ULL, grains::square(32)); +} + +BOOST_AUTO_TEST_CASE(square_64) +{ + BOOST_REQUIRE_EQUAL(9223372036854775808ULL, grains::square(64)); +} + +BOOST_AUTO_TEST_CASE(total) +{ + BOOST_REQUIRE_EQUAL(18446744073709551615ULL, grains::total()); +} +#endif diff --git a/hamming/CMakeLists.txt b/hamming/CMakeLists.txt new file mode 100644 index 00000000..90735352 --- /dev/null +++ b/hamming/CMakeLists.txt @@ -0,0 +1 @@ +exercism(hamming) diff --git a/hamming/example.cpp b/hamming/example.cpp new file mode 100644 index 00000000..819e2085 --- /dev/null +++ b/hamming/example.cpp @@ -0,0 +1,23 @@ +#include "hamming.h" +#include + +namespace hamming +{ + +extern int compute(std::string const& lhs, std::string const& rhs) +{ + if (rhs.length() < lhs.length()) { + return compute(rhs, lhs); + } + int count = 0; + for (auto p = std::mismatch(lhs.begin(), lhs.end(), rhs.begin()); + p.first != lhs.end(); + p = std::mismatch(p.first, lhs.end(), p.second)) { + ++p.first; + ++p.second; + ++count; + } + return count; +} + +} diff --git a/hamming/example.h b/hamming/example.h new file mode 100644 index 00000000..b092c53b --- /dev/null +++ b/hamming/example.h @@ -0,0 +1,13 @@ +#if !defined(HAMMING_H) +#define HAMMING_H + +#include + +namespace hamming +{ + +extern int compute(std::string const& lhs, std::string const& rhs); + +} + +#endif diff --git a/hamming/hamming_test.cpp b/hamming/hamming_test.cpp new file mode 100644 index 00000000..9db1833d --- /dev/null +++ b/hamming/hamming_test.cpp @@ -0,0 +1,50 @@ +#include "hamming.h" +#define BOOST_TEST_MAIN +#include + +BOOST_AUTO_TEST_CASE(no_difference_between_identical_strands) +{ + BOOST_REQUIRE_EQUAL(0, hamming::compute("A", "A")); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(complete_hamming_distance_for_single_nucleotide_strand) +{ + BOOST_REQUIRE_EQUAL(1, hamming::compute("A", "G")); +} + +BOOST_AUTO_TEST_CASE(complete_hamming_distance_for_small_strand) +{ + BOOST_REQUIRE_EQUAL(2, hamming::compute("AG", "CT")); +} + +BOOST_AUTO_TEST_CASE(small_hamming_distance) +{ + BOOST_REQUIRE_EQUAL(1, hamming::compute("AT", "CT")); +} + +BOOST_AUTO_TEST_CASE(small_hamming_distance_in_longer_strand) +{ + BOOST_REQUIRE_EQUAL(1, hamming::compute("GGACG", "GGTCG")); +} + +BOOST_AUTO_TEST_CASE(ignores_extra_length_on_first_strand_when_longer) +{ + BOOST_REQUIRE_EQUAL(0, hamming::compute("AAAG", "AAA")); +} + +BOOST_AUTO_TEST_CASE(ignores_extra_length_on_other_strand_when_longer) +{ + BOOST_REQUIRE_EQUAL(0, hamming::compute("AAA", "AAAG")); +} + +BOOST_AUTO_TEST_CASE(large_hamming_distance) +{ + BOOST_REQUIRE_EQUAL(4, hamming::compute("GATACA", "GCATAA")); +} + +BOOST_AUTO_TEST_CASE(hamming_distance_in_very_long_strand) +{ + BOOST_REQUIRE_EQUAL(9, hamming::compute("GGACGGATTCTG", "AGGACGGATTCT")); +} +#endif diff --git a/leap/CMakeLists.txt b/leap/CMakeLists.txt new file mode 100644 index 00000000..52134c62 --- /dev/null +++ b/leap/CMakeLists.txt @@ -0,0 +1 @@ +exercism(leap) diff --git a/leap/example.h b/leap/example.h new file mode 100644 index 00000000..9a8980a2 --- /dev/null +++ b/leap/example.h @@ -0,0 +1,14 @@ +#if !defined(LEAP_H) +#define LEAP_H + +namespace leap +{ + +inline bool is_leap_year(int year) +{ + return (year % 100) ? (year % 4 == 0) : (year % 400 == 0); +} + +} + +#endif diff --git a/leap/leap_test.cpp b/leap/leap_test.cpp new file mode 100644 index 00000000..f83eac53 --- /dev/null +++ b/leap/leap_test.cpp @@ -0,0 +1,30 @@ +#include "leap.h" +#define BOOST_TEST_MAIN +#include + +BOOST_AUTO_TEST_CASE(a_known_leap_year) +{ + BOOST_REQUIRE(leap::is_leap_year(1996)); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(any_old_year) +{ + BOOST_REQUIRE(!leap::is_leap_year(1997)); +} + +BOOST_AUTO_TEST_CASE(turn_of_the_20th_century) +{ + BOOST_REQUIRE(!leap::is_leap_year(1900)); +} + +BOOST_AUTO_TEST_CASE(turn_of_the_21st_century) +{ + BOOST_REQUIRE(leap::is_leap_year(2000)); +} + +BOOST_AUTO_TEST_CASE(turn_of_the_25th_century) +{ + BOOST_REQUIRE(leap::is_leap_year(2400));; +} +#endif diff --git a/nucleotide-count/CMakeLists.txt b/nucleotide-count/CMakeLists.txt new file mode 100644 index 00000000..5787e2c1 --- /dev/null +++ b/nucleotide-count/CMakeLists.txt @@ -0,0 +1 @@ +exercism(nucleotide-count) diff --git a/nucleotide-count/example.cpp b/nucleotide-count/example.cpp new file mode 100644 index 00000000..27a8fc9d --- /dev/null +++ b/nucleotide-count/example.cpp @@ -0,0 +1,27 @@ +#include "nucleotide_count.h" +#include + +namespace dna +{ + +counter::counter(std::string const& sequence) + : counts_({ {'A', 0}, {'C', 0}, {'G', 0}, {'T', 0} }) +{ + for (auto nucleotide : sequence) { + counts_[nucleotide]++; + } +} + +int counter::count(char nucleotide) const +{ + if (nucleotide == 'U') { + return 0; + } + const auto it = counts_.find(nucleotide); + if (it == counts_.end()) { + throw std::invalid_argument("Unknown nucleotide"); + } + return it->second; +} + +} diff --git a/nucleotide-count/example.h b/nucleotide-count/example.h new file mode 100644 index 00000000..f8b43ddf --- /dev/null +++ b/nucleotide-count/example.h @@ -0,0 +1,28 @@ +#if !defined(NUCLEOTIDE_COUNT_H) +#define NUCLEOTIDE_COUNT_H + +#include +#include + +namespace dna +{ + +class counter +{ +public: + counter(std::string const& sequence); + + std::map const& nucleotide_counts() const + { + return counts_; + } + + int count(char nucleotide) const; + +private: + std::map counts_; +}; + +} + +#endif diff --git a/nucleotide-count/nucleotide_count_test.cpp b/nucleotide-count/nucleotide_count_test.cpp new file mode 100644 index 00000000..ef406367 --- /dev/null +++ b/nucleotide-count/nucleotide_count_test.cpp @@ -0,0 +1,93 @@ +#include "nucleotide_count.h" +#define BOOST_TEST_MAIN +#include +#include + +namespace boost +{ + +// teach Boost.Test how to print std::pair +template +inline wrap_stringstream& +operator<<(wrap_stringstream& wrapped, std::pair const& item) +{ + return wrapped << '<' << item.first << ',' << item.second << '>'; +} + +} + +BOOST_AUTO_TEST_CASE(has_no_nucleotides) +{ + const dna::counter dna(""); + const std::map expected{ {'A', 0}, {'T', 0}, {'C', 0}, {'G', 0} }; + + const auto actual = dna.nucleotide_counts(); + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), actual.begin(), actual.end()); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(has_no_adenosine) +{ + const dna::counter dna(""); + + BOOST_REQUIRE_EQUAL(0, dna.count('A')); +} + +BOOST_AUTO_TEST_CASE(repetitive_cytidine_gets_counts) +{ + const dna::counter dna("CCCCC"); + + BOOST_REQUIRE_EQUAL(5, dna.count('C')); +} + +BOOST_AUTO_TEST_CASE(repetitive_sequence_has_only_guanosine) +{ + const dna::counter dna("GGGGGGGG"); + const std::map expected{ {'A', 0}, {'T', 0}, {'C', 0}, {'G', 8} }; + + const auto actual = dna.nucleotide_counts(); + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), actual.begin(), actual.end()); +} + +BOOST_AUTO_TEST_CASE(counts_only_thymidine) +{ + const dna::counter dna("GGGGTAACCCGG"); + + BOOST_REQUIRE_EQUAL(1, dna.count('T')); +} + +BOOST_AUTO_TEST_CASE(counts_a_nucleotide_only_once) +{ + const dna::counter dna("GGTTGG"); + + dna.count('T'); + + BOOST_REQUIRE_EQUAL(2, dna.count('T')); +} + +BOOST_AUTO_TEST_CASE(has_no_uracil) +{ + const dna::counter dna("GGTTGG"); + + BOOST_REQUIRE_EQUAL(0, dna.count('U')); +} + +BOOST_AUTO_TEST_CASE(validates_nucleotides) +{ + const dna::counter dna("GGTTGG"); + + BOOST_REQUIRE_THROW(dna.count('X'), std::invalid_argument); +} + +BOOST_AUTO_TEST_CASE(counts_all_nucleotides) +{ + const dna::counter dna("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"); + std::map expected{ {'A', 20}, {'T', 21}, {'G', 17}, {'C', 12} }; + + auto actual = dna.nucleotide_counts(); + + BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), actual.begin(), actual.end()); +} +#endif diff --git a/phone-number/CMakeLists.txt b/phone-number/CMakeLists.txt new file mode 100644 index 00000000..8e0f65a5 --- /dev/null +++ b/phone-number/CMakeLists.txt @@ -0,0 +1 @@ +exercism(phone-number) diff --git a/phone-number/example.cpp b/phone-number/example.cpp new file mode 100644 index 00000000..0da005cb --- /dev/null +++ b/phone-number/example.cpp @@ -0,0 +1,68 @@ +#include "phone_number.h" +#include +#include +#include +#include + +using namespace std; + +namespace +{ + +const int area_code_length = 3; +const int exchange_length = 3; +const int extension_length = 4; +const int valid_number_length = area_code_length + exchange_length + extension_length; +const string cleaned_invalid_number(valid_number_length, '0'); + +string clean_number(const string& text) +{ + string result; + copy_if(text.begin(), text.end(), back_inserter(result), + [](char c) { return isdigit(c) != 0; }); + if (result.length() == valid_number_length + 1) { + if (result[0] == '1') { + result.erase(result.begin()); + } else { + result = cleaned_invalid_number; + } + } else if (result.length() < valid_number_length) { + result = cleaned_invalid_number; + } + return result; +} + +} + +phone_number::phone_number(const string& text) + : digits_(clean_number(text)) +{ +} + +string phone_number::area_code() const +{ + return digits_.substr(0, area_code_length); +} + +string phone_number::exchange() const +{ + return digits_.substr(area_code_length, exchange_length); +} + +string phone_number::extension() const +{ + return digits_.substr(area_code_length + exchange_length); +} + +string phone_number::number() const +{ + return digits_; +} + +phone_number::operator std::string() const +{ + ostringstream buff; + buff << '(' << area_code() << ") " << exchange() << '-' << extension(); + return buff.str(); +} + diff --git a/phone-number/example.h b/phone-number/example.h new file mode 100644 index 00000000..a2059a62 --- /dev/null +++ b/phone-number/example.h @@ -0,0 +1,24 @@ +#if !defined(PHONE_NUMBER_H) +#define PHONE_NUMBER_H + +#include + +class phone_number +{ +public: + phone_number(const std::string& text); + + std::string area_code() const; + std::string number() const; + + explicit operator std::string() const; + +private: + std::string extension() const; + + std::string exchange() const; + + const std::string digits_; +}; + +#endif diff --git a/phone-number/phone_number_test.cpp b/phone-number/phone_number_test.cpp new file mode 100644 index 00000000..dd768c98 --- /dev/null +++ b/phone-number/phone_number_test.cpp @@ -0,0 +1,54 @@ +#include "phone_number.h" +#define BOOST_TEST_MAIN +#include + +BOOST_AUTO_TEST_CASE(cleans_parens_dashes_and_spaces_from_the_number) +{ + const phone_number phone("(123) 456-7890"); + + BOOST_REQUIRE_EQUAL("1234567890", phone.number()); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(cleans_numbers_with_dots) +{ + const phone_number phone("123.456.7890"); + + BOOST_REQUIRE_EQUAL("1234567890", phone.number()); +} + +BOOST_AUTO_TEST_CASE(valid_when_11_digits_and_first_digit_is_1) +{ + const phone_number phone("11234567890"); + + BOOST_REQUIRE_EQUAL("1234567890", phone.number()); +} + +BOOST_AUTO_TEST_CASE(invalid_when_11_digits) +{ + const phone_number phone("21234567890"); + + BOOST_REQUIRE_EQUAL("0000000000", phone.number()); +} + +BOOST_AUTO_TEST_CASE(invalid_when_9_digits) +{ + const phone_number phone("123456789"); + + BOOST_REQUIRE_EQUAL("0000000000", phone.number()); +} + +BOOST_AUTO_TEST_CASE(has_an_area_code) +{ + const phone_number phone("1234567890"); + + BOOST_REQUIRE_EQUAL("123", phone.area_code()); +} + +BOOST_AUTO_TEST_CASE(formats_a_number) +{ + const phone_number phone("1234567890"); + + BOOST_REQUIRE_EQUAL("(123) 456-7890", std::string(phone)); +} +#endif diff --git a/rna-transcription/CMakeLists.txt b/rna-transcription/CMakeLists.txt new file mode 100644 index 00000000..711c450d --- /dev/null +++ b/rna-transcription/CMakeLists.txt @@ -0,0 +1 @@ +exercism(rna-transcription) diff --git a/rna-transcription/example.cpp b/rna-transcription/example.cpp new file mode 100644 index 00000000..d9b6ef27 --- /dev/null +++ b/rna-transcription/example.cpp @@ -0,0 +1,29 @@ +#include "rna_transcription.h" +#include +#include + +using namespace std; + +namespace transcription +{ + +extern char to_rna(const char nucleotide) +{ + const string dna_nucleotides("CGAT"); + const string rna_nucleotides("GCUA"); + const auto pos = dna_nucleotides.find(nucleotide); + if (pos != string::npos) { + return rna_nucleotides[pos]; + } + return 0; +} + +extern string to_rna(string const& sequence) +{ + string transcription; + transform(sequence.begin(), sequence.end(), back_inserter(transcription), + [](char c) { return to_rna(c); }); + return transcription; +} + +} diff --git a/rna-transcription/example.h b/rna-transcription/example.h new file mode 100644 index 00000000..f7a6fe21 --- /dev/null +++ b/rna-transcription/example.h @@ -0,0 +1,14 @@ +#if !defined(RNA_TRANSCRIPTION_H) +#define RNA_TRANSCRIPTION_H + +#include + +namespace transcription +{ + +extern char to_rna(char nucleotide); +extern std::string to_rna(std::string const& nucleotide); + +} + +#endif diff --git a/rna-transcription/rna_transcription_test.cpp b/rna-transcription/rna_transcription_test.cpp new file mode 100644 index 00000000..3b5f6390 --- /dev/null +++ b/rna-transcription/rna_transcription_test.cpp @@ -0,0 +1,30 @@ +#include "rna_transcription.h" +#define BOOST_TEST_MAIN +#include + +BOOST_AUTO_TEST_CASE(transcribes_cytidine_to_guanosine) +{ + BOOST_REQUIRE_EQUAL('G', transcription::to_rna('C')); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(transcribes_guanosine_to_cytidine) +{ + BOOST_REQUIRE_EQUAL('C', transcription::to_rna('G')); +} + +BOOST_AUTO_TEST_CASE(transcribes_adenosine_to_uracil) +{ + BOOST_REQUIRE_EQUAL('U', transcription::to_rna('A')); +} + +BOOST_AUTO_TEST_CASE(transcribes_thymidine_to_adenosine) +{ + BOOST_REQUIRE_EQUAL('A', transcription::to_rna('T')); +} + +BOOST_AUTO_TEST_CASE(transcribes_all_dna_nucleotides_to_their_rna_complements) +{ + BOOST_REQUIRE_EQUAL("UGCACCAGAAUU", transcription::to_rna("ACGTGGTCTTAA")); +} +#endif diff --git a/robot-name/CMakeLists.txt b/robot-name/CMakeLists.txt new file mode 100644 index 00000000..052e2ada --- /dev/null +++ b/robot-name/CMakeLists.txt @@ -0,0 +1 @@ +exercism(robot-name) diff --git a/robot-name/example.cpp b/robot-name/example.cpp new file mode 100644 index 00000000..782afc8d --- /dev/null +++ b/robot-name/example.cpp @@ -0,0 +1,54 @@ +#include "robot_name.h" +#include +#include + +using namespace std; + +namespace robot_name +{ + +namespace +{ + +string next_prefix(string prefix) +{ + string next{prefix}; + const string letters{"ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz"}; + if (prefix[1] == letters.back()) { + if (prefix[0] == letters.back()) { + throw range_error("prefix combinations exhausted"); + } + next[1] = letters[0]; + next[0] = letters[letters.find(next[0]) + 1]; + } else { + next[1] = letters[letters.find(next[1]) + 1]; + } + return next; +} + +string generate_name() +{ + static string prefix = "AA"; + static int unit_number = 100; + ostringstream buff; + if (unit_number > 999) { + prefix = next_prefix(prefix); + unit_number = 100; + } + buff << prefix << unit_number++; + return buff.str(); +} + +} + +robot::robot() + : name_(generate_name()) +{ +} + +void robot::reset() +{ + name_ = generate_name(); +} + +} diff --git a/robot-name/example.h b/robot-name/example.h new file mode 100644 index 00000000..6543ab0c --- /dev/null +++ b/robot-name/example.h @@ -0,0 +1,24 @@ +#if !defined(ROBOT_NAME_H) +#define ROBOT_NAME_H + +#include + +namespace robot_name +{ + +class robot +{ +public: + robot(); + + std::string name() const { return name_; } + + void reset(); + +private: + std::string name_; +}; + +} + +#endif diff --git a/robot-name/robot_name_test.cpp b/robot-name/robot_name_test.cpp new file mode 100644 index 00000000..cca7f829 --- /dev/null +++ b/robot-name/robot_name_test.cpp @@ -0,0 +1,57 @@ +#include "robot_name.h" +#define BOOST_TEST_MAIN +#include +#include + +using namespace std; + +namespace +{ +const boost::regex name_pattern{R"name(^\w{2}\d{3}$)name"}; +} + +BOOST_AUTO_TEST_CASE(has_a_name) +{ + const robot_name::robot robot; + + BOOST_REQUIRE(boost::regex_match(robot.name(), name_pattern)); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(name_is_the_same_each_time) +{ + const robot_name::robot robot; + + BOOST_REQUIRE_EQUAL(robot.name(), robot.name()); +} + +BOOST_AUTO_TEST_CASE(different_robots_have_different_names) +{ + const robot_name::robot robot_one; + const robot_name::robot robot_two; + + BOOST_REQUIRE_NE(robot_one.name(), robot_two.name()); +} + +BOOST_AUTO_TEST_CASE(is_able_to_reset_name) +{ + robot_name::robot robot; + const auto original_name = robot.name(); + + robot.reset(); + + BOOST_REQUIRE_NE(original_name, robot.name()); +} + +BOOST_AUTO_TEST_CASE(exhausting_digits_yields_different_names) +{ + robot_name::robot robot; + auto last_name = robot.name(); + + for (int i = 0; i < 1000; ++i) { + robot.reset(); + BOOST_REQUIRE_NE(last_name, robot.name()); + BOOST_REQUIRE(boost::regex_match(robot.name(), name_pattern)); + } +} +#endif diff --git a/space-age/CMakeLists.txt b/space-age/CMakeLists.txt new file mode 100644 index 00000000..ecbe4ae0 --- /dev/null +++ b/space-age/CMakeLists.txt @@ -0,0 +1 @@ +exercism(space-age) diff --git a/space-age/example.cpp b/space-age/example.cpp new file mode 100644 index 00000000..9304a375 --- /dev/null +++ b/space-age/example.cpp @@ -0,0 +1,68 @@ +#include "space_age.h" + +namespace space_age +{ + +namespace +{ +const double earth_years_per_second = 1.0/31557600.0; +const double earth_years_per_mercury_year = 0.2408467; +const double earth_years_per_venus_year = 0.61519726; +const double earth_years_per_mars_year = 1.8808158; +const double earth_years_per_jupiter_year = 11.862615; +const double earth_years_per_saturn_year = 29.447498; +const double earth_years_per_uranus_year = 84.016846; +const double earth_years_per_neptune_year = 164.79132; +} + +space_age::space_age(unsigned long long secs) + : seconds_(secs) +{ +} + +unsigned long long space_age::seconds() const +{ + return seconds_; +} + +double space_age::on_earth() const +{ + return seconds_*earth_years_per_second; +} + +double space_age::on_mercury() const +{ + return on_earth()/earth_years_per_mercury_year; +} + +double space_age::on_venus() const +{ + return on_earth()/earth_years_per_venus_year; +} + +double space_age::on_mars() const +{ + return on_earth()/earth_years_per_mars_year; +} + +double space_age::on_jupiter() const +{ + return on_earth()/earth_years_per_jupiter_year; +} + +double space_age::on_saturn() const +{ + return on_earth()/earth_years_per_saturn_year; +} + +double space_age::on_uranus() const +{ + return on_earth()/earth_years_per_uranus_year; +} + +double space_age::on_neptune() const +{ + return on_earth()/earth_years_per_neptune_year; +} + +} diff --git a/space-age/example.h b/space-age/example.h new file mode 100644 index 00000000..2d0da396 --- /dev/null +++ b/space-age/example.h @@ -0,0 +1,28 @@ +#if !defined(SPACE_AGE_H) +#define SPACE_AGE_H + +namespace space_age +{ + +class space_age +{ +public: + space_age(unsigned long long secs); + + unsigned long long seconds() const; + double on_earth() const; + double on_mercury() const; + double on_venus() const; + double on_mars() const; + double on_jupiter() const; + double on_saturn() const; + double on_uranus() const; + double on_neptune() const; + +private: + unsigned long long seconds_; +}; + +} + +#endif diff --git a/space-age/space_age_test.cpp b/space-age/space_age_test.cpp new file mode 100644 index 00000000..05e9fc01 --- /dev/null +++ b/space-age/space_age_test.cpp @@ -0,0 +1,81 @@ +#include "space_age.h" +#define BOOST_TEST_MAIN +#include +#include + +namespace +{ +const double accuracy = 0.005; +} + +BOOST_AUTO_TEST_CASE(age_in_seconds) +{ + const space_age::space_age age(1000000); + + BOOST_REQUIRE_EQUAL(1000000, age.seconds()); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(age_in_earth_years) +{ + const space_age::space_age age(1000000000); + + BOOST_REQUIRE_LT(std::abs(31.69 - age.on_earth()), accuracy); +} + +BOOST_AUTO_TEST_CASE(age_in_mercury_years) +{ + const space_age::space_age age(2134835688); + + BOOST_REQUIRE_LT(std::abs(67.65 - age.on_earth()), accuracy); + BOOST_REQUIRE_LT(std::abs(280.88 - age.on_mercury()), accuracy); +} + +BOOST_AUTO_TEST_CASE(age_in_venus_years) +{ + const space_age::space_age age(189839836); + + BOOST_REQUIRE_LT(std::abs(6.02- age.on_earth()), accuracy); + BOOST_REQUIRE_LT(std::abs(9.78 - age.on_venus()), accuracy); +} + +BOOST_AUTO_TEST_CASE(age_in_mars_years) +{ + const space_age::space_age age(2329871239); + + BOOST_REQUIRE_LT(std::abs(73.83 - age.on_earth()), accuracy); + BOOST_REQUIRE_LT(std::abs(39.25 - age.on_mars()), accuracy); +} + +BOOST_AUTO_TEST_CASE(age_in_jupiter_years) +{ + const space_age::space_age age(901876382); + + BOOST_REQUIRE_LT(std::abs(28.58 - age.on_earth()), accuracy); + BOOST_REQUIRE_LT(std::abs(2.41 - age.on_jupiter()), accuracy); +} + +BOOST_AUTO_TEST_CASE(age_in_saturn_years) +{ + const space_age::space_age age(3000000000); + + BOOST_REQUIRE_LT(std::abs(95.06 - age.on_earth()), accuracy); + BOOST_REQUIRE_LT(std::abs(3.23 - age.on_saturn()), accuracy); +} + +BOOST_AUTO_TEST_CASE(age_in_uranus_years) +{ + const space_age::space_age age(3210123456); + + BOOST_REQUIRE_LT(std::abs(101.72 - age.on_earth()), accuracy); + BOOST_REQUIRE_LT(std::abs(1.21 - age.on_uranus()), accuracy); +} + +BOOST_AUTO_TEST_CASE(age_in_neptune_year) +{ + const space_age::space_age age(8210123456); + + BOOST_REQUIRE_LT(std::abs(260.16 - age.on_earth()), accuracy); + BOOST_REQUIRE_LT(std::abs(1.58 - age.on_neptune()), accuracy); +} +#endif diff --git a/triangle/CMakeLists.txt b/triangle/CMakeLists.txt new file mode 100644 index 00000000..0f6d2ef7 --- /dev/null +++ b/triangle/CMakeLists.txt @@ -0,0 +1 @@ +exercism(triangle) diff --git a/triangle/example.cpp b/triangle/example.cpp new file mode 100644 index 00000000..8711c3e1 --- /dev/null +++ b/triangle/example.cpp @@ -0,0 +1,36 @@ +#include "triangle.h" +#include + +namespace triangle +{ + +namespace +{ + +bool triangle_equality(double a, double b, double c) +{ + return a < (b + c) + && b < (a + c) + && c < (a + b); +} + +} + +extern flavor kind(double a, double b, double c) +{ + if (a == 0 || b == 0 || c == 0) { + throw std::domain_error("Zero triangle"); + } + if (a < 0 || b < 0 || c < 0 || !triangle_equality(a, b, c)) { + return illegal; + } + if (a == b && b == c) { + return equilateral; + } + if (a == b || b == c || a == c) { + return isosceles; + } + return scalene; +} + +} diff --git a/triangle/example.h b/triangle/example.h new file mode 100644 index 00000000..36d52536 --- /dev/null +++ b/triangle/example.h @@ -0,0 +1,19 @@ +#if !defined(TRIANGLE_H) +#define TRIANGLE_H + +namespace triangle +{ + +enum flavor +{ + equilateral, + isosceles, + scalene, + illegal +}; + +extern flavor kind(double a, double b, double c); + +}; + +#endif diff --git a/triangle/triangle_test.cpp b/triangle/triangle_test.cpp new file mode 100644 index 00000000..c5c560df --- /dev/null +++ b/triangle/triangle_test.cpp @@ -0,0 +1,81 @@ +#include "triangle.h" +#define BOOST_TEST_MAIN +#include +#include + +BOOST_AUTO_TEST_CASE(equilateral_triangles_have_equal_sides) +{ + BOOST_REQUIRE_EQUAL(triangle::equilateral, triangle::kind(2, 2, 2)); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(larger_equilateral_triangles_also_have_equal_sides) +{ + BOOST_REQUIRE_EQUAL(triangle::equilateral, triangle::kind(10, 10, 10)); +} + +BOOST_AUTO_TEST_CASE(isosceles_triangles_have_last_two_sides_equal) +{ + BOOST_REQUIRE_EQUAL(triangle::isosceles, triangle::kind(3, 4, 4)); +} + +BOOST_AUTO_TEST_CASE(isosceles_triangles_have_first_and_last_sides_equal) +{ + BOOST_REQUIRE_EQUAL(triangle::isosceles, triangle::kind(4, 3, 4)); +} + +BOOST_AUTO_TEST_CASE(isosceles_triangles_have_first_two_sides_equal) +{ + BOOST_REQUIRE_EQUAL(triangle::isosceles, triangle::kind(4, 4, 3)); +} + +BOOST_AUTO_TEST_CASE(isosceles_triangles_have_in_fact_exactly_two_sides_equal) +{ + BOOST_REQUIRE_EQUAL(triangle::isosceles, triangle::kind(10, 10, 2)); +} + +BOOST_AUTO_TEST_CASE(scalene_triangles_have_no_equal_sides) +{ + BOOST_REQUIRE_EQUAL(triangle::scalene, triangle::kind(3, 4, 5)); +} + +BOOST_AUTO_TEST_CASE(scalene_triangles_have_no_equal_sides_at_a_larger_scale_too) +{ + BOOST_REQUIRE_EQUAL(triangle::scalene, triangle::kind(10, 11, 12)); +} + +BOOST_AUTO_TEST_CASE(scalene_triangles_have_no_equal_sides_in_descending_order_either) +{ + BOOST_REQUIRE_EQUAL(triangle::scalene, triangle::kind(5, 4, 2)); +} + +BOOST_AUTO_TEST_CASE(very_small_triangles_are_legal) +{ + BOOST_REQUIRE_EQUAL(triangle::scalene, triangle::kind(0.4, 0.6, 0.3)); +} + +BOOST_AUTO_TEST_CASE(triangles_with_no_size_are_illegal) +{ + BOOST_REQUIRE_THROW(triangle::kind(0, 0, 0), std::domain_error); +} + +BOOST_AUTO_TEST_CASE(triangles_with_negative_sides_are_illegal) +{ + BOOST_REQUIRE_EQUAL(triangle::illegal, triangle::kind(3, 4, -5)); +} + +BOOST_AUTO_TEST_CASE(triangles_violating_triangle_inequality_are_illegal) +{ + BOOST_REQUIRE_EQUAL(triangle::illegal, triangle::kind(1, 1, 3)); +} + +BOOST_AUTO_TEST_CASE(medium_triangles_violating_triangle_inequality_are_illegal) +{ + BOOST_REQUIRE_EQUAL(triangle::illegal, triangle::kind(2, 4, 2)); +} + +BOOST_AUTO_TEST_CASE(larger_triangles_violating_triangle_inequality_are_illegal) +{ + BOOST_REQUIRE_EQUAL(triangle::illegal, triangle::kind(7, 3, 2)); +} +#endif diff --git a/word-count/CMakeLists.txt b/word-count/CMakeLists.txt new file mode 100644 index 00000000..d9933403 --- /dev/null +++ b/word-count/CMakeLists.txt @@ -0,0 +1 @@ +exercism(word-count) diff --git a/word-count/example.cpp b/word-count/example.cpp new file mode 100644 index 00000000..c488871c --- /dev/null +++ b/word-count/example.cpp @@ -0,0 +1,57 @@ +#include "word_count.h" +#include +#include +#include +#include +#include + +using namespace std; + +namespace +{ + +vector split_words(string const& text) +{ + vector words; + string::size_type start = 0; + string::size_type space = text.find_first_of(" \n"); + for (; space != string::npos; space = text.find_first_of(" \n", start)) { + if (space > start) { + words.push_back(text.substr(start, space-start)); + } + start = space + 1; + } + words.push_back(text.substr(start)); + return words; +} + +string to_lower(string const& text) +{ + string lowered{text}; + boost::to_lower(lowered); + return lowered; +} + +string strip_punctuation(string const& text) +{ + string stripped; + remove_copy_if(text.begin(), text.end(), back_inserter(stripped), + [](char c) { return ispunct(c) != 0; }); + return stripped; +} + +} + +namespace word_count +{ + +extern map words(string const& text) +{ + map counts; + for (string word : split_words(to_lower(strip_punctuation(text)))) { + counts[word]++; + } + return counts; +} + +} diff --git a/word-count/example.h b/word-count/example.h new file mode 100644 index 00000000..d68d57dd --- /dev/null +++ b/word-count/example.h @@ -0,0 +1,14 @@ +#if !defined(WORD_COUNT_H) +#define WORD_COUNT_H + +#include +#include + +namespace word_count +{ + +extern std::map words(std::string const& text); + +} + +#endif diff --git a/word-count/word_count_test.cpp b/word-count/word_count_test.cpp new file mode 100644 index 00000000..29c2546f --- /dev/null +++ b/word-count/word_count_test.cpp @@ -0,0 +1,96 @@ +#include "word_count.h" +#define BOOST_TEST_MAIN +#include +#include + +using namespace std; + +namespace boost +{ + +// teach Boost.Test how to print std::pair +template +inline wrap_stringstream& +operator<<(wrap_stringstream& wrapped, std::pair const& item) +{ + return wrapped << '<' << item.first << ',' << item.second << '>'; +} + +} + +#define REQUIRE_EQUAL_CONTAINERS(left_, right_) \ + BOOST_REQUIRE_EQUAL_COLLECTIONS(left_.begin(), left_.end(), right_.begin(), right_.end()) + +BOOST_AUTO_TEST_CASE(counts_one_word) +{ + const map expected{{"word", 1}}; + + const auto actual = word_count::words("word"); + + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +#if defined(EXERCISM_RUN_ALL_TESTS) +BOOST_AUTO_TEST_CASE(counts_one_of_each) +{ + const map expected{{"one", 1}, {"of", 1}, {"each", 1}}; + + const auto actual = word_count::words("one of each"); + + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(counts_multiple_occurrences) +{ + const map expected{{"one", 1}, {"fish", 4}, {"two", 1}, {"red", 1}, {"blue", 1}}; + + const auto actual = word_count::words("one fish two fish red fish blue fish"); + + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(ignores_punctuation) +{ + const map expected{{"car", 1}, {"carpet", 1}, {"as", 1}, {"java", 1}, {"javascript", 1}}; + + const auto actual = word_count::words("car : carpet as java : javascript!!&@$%^&"); + + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(includes_numbers) +{ + const map expected{{"testing", 2}, {"1", 1}, {"2", 1}}; + + const auto actual = word_count::words("testing, 1, 2 testing"); + + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(normalizes_case) +{ + const map expected{{"go", 3}}; + + const auto actual = word_count::words("go Go GO"); + + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(counts_constructor) +{ + const map expected{{"constructor", 2}}; + + const auto actual = word_count::words("constructor Constructor"); + + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} + +BOOST_AUTO_TEST_CASE(counts_multiline) +{ + const map expected{{"hello", 1}, {"world", 1}}; + + const auto actual = word_count::words("hello\nworld"); + + REQUIRE_EQUAL_CONTAINERS(expected, actual); +} +#endif